The role of vitamin A in bile acid synthesis and transport and the relevance for cholestatic liver disease Hoeke, Martijn Oscar

Transcription

1 University of Groningen The role of vitmin A in ile i synthesis n trnsport n the relevne for holestti liver isese Hoeke, Mrtijn Osr IMPORTANT NOTE: You re vise to onsult the pulisher's version (pulisher's PDF) if you wish to ite from it. Plese hek the oument version elow. Doument Version Pulisher's PDF, lso known s Version of reor Pulition te: 2013 Link to pulition in University of Groningen/UMCG reserh tse Cittion for pulishe version (APA): Hoeke, M. O. (2013). The role of vitmin A in ile i synthesis n trnsport n the relevne for holestti liver isese Groningen: s.n. Copyright Other thn for stritly personl use, it is not permitte to ownlo or to forwr/istriute the text or prt of it without the onsent of the uthor(s) n/or opyright holer(s), unless the work is uner n open ontent liense (like Cretive Commons). Tkeown poliy If you elieve tht this oument rehes opyright plese ontt us proviing etils, n we will remove ess to the work immeitely n investigte your lim. Downloe from the University of Groningen/UMCG reserh tse (Pure): For tehnil resons the numer of uthors shown on this over pge is limite to 10 mximum. Downlo te:

2 Chpter 3 Humn FXR Regultes SHP Expression Through Diret Bining to n LRH1 Bining Site, Inepenent of n IR1 n LRH1 Mrtijn O. Hoeke, Jnette Heegsm, Mrk Hoekstr, Hn Moshge n Kls Nio Fer Deprtment of Gstroenterology n Heptology, University Meil Center Groningen, Groningen, University of Groningen, The Netherlns Sumitte

3 Chpter 3 Astrt FXR/RXRα is the mster trnsriptionl regultor of ile slt synthesis n trnsport in liver n intestine. FXR is tivte y ile is, RXRα y the vitmin A erivtive 9is retinoi i (9RA). Remrkly, 9RA inhiits ining of FXR/ RXRα to its response element, n inverte repet1 (IR1). Still, most FXR/RXRα trget genes re mximlly expresse in the presene of oth ligns, inluing the smll heteroimer prtner (SHP). Here, we revisite the FXR/RXRαmeite regultion of humn SHP. A 579p hshp promoter element ws nlyze to lote FXR/CDCA n RXRα/ 9RAresponsive elements. hshp promoter onstruts were nlyze in FXR/ RXRαtrnsfete DLD1, HEK293 n HepG2 ells expose to CDCA, GW4064 (syntheti FXR lign) n/or 9RA. FXRDNA intertions were nlyze y in vitro pull own ssys. hshp promoter elements lking the previously ientifie IR1 (291/279) lrgely mintine their tivtion y FXR/CDCA, ut were unresponsive to 9RA. FXRmeite tivtion of the hshp promoter ws primrily epenent on the 122/69 region. Pull own ssys revele iret ining of FXR to the 122/69 sequene, whih ws rogte y sitespeifi muttions in ining site for the liver reeptor homolog1 (LRH1) t 78/70. These muttions strongly impire the FXR/CDCAmeite tivtion, even in the ontext of hshp promoter ontining the IR1. LRH1 i not inrese FXR/RXRαmeite tivtion of hshp promoter tivity. FXR/CDCAtivte expression of SHP is primrily meite through iret ining to n LRH1 ining site, whih is not moulte y LRH1 n unresponsive to 9RA. 9RAinue expression of SHP requires the IR1 tht overlps with DR2 n DR4. This estlishes for the first time ostimultory, ut inepenent, tion of FXR n RXRα gonists. Introution The frnesoi X reeptor (FXR/NR1H4) n the liver reeptor homolog1 (LRH1/ NR5A2) re entrl ftors in the ontrol of ile slt homeostsis. In the liver, LRH1 regultes expression of holesterol 7lphhyroxylse (CYP7A1), the rtelimiting enzyme in ile slt synthesis, s well s the ile slt export pump (BSEP/ABCB11) the mjor heptoiliry ile slt exporter (1, 2). FXR typilly ts together with the retinoi X reeptorlph (RXRα/NR2B1) n upon tivtion y ile slts inues the expression of BSEP (3, 4) n the smll heteroimer prtner (SHP/NR0B2) (57). SHP, in turn, ins to LRH1 n therey inhiits the expression of CYP7A1 (6). In similr wy, SHP my in the RXRα/retinoi i reeptor (RAR) heteroimer n therey lso repress expression of the hepti ile slt importer N turoholte otrnsporting polypeptie (NTCP/SLC10A1) (8). SHPepenent repression of ile slt synthesis ts in prllel with firolst growth ftor 19 (FGF19)meite 84

4 FXR Regultes SHP Expression Through LRE, Inepenent of n IR1 n LRH1 repression, whih my originte either from FXRinue expression in the intestine (in roents) (9) or the liver (prtiulr in humns) (10). Both LRH1 n FXR elong to the superfmily of nuler reeptors. FXR/RXRα ins to n inverte repet sequene spe y 1 nuleotie (IR1) onforming to the onsensus G/AGGTCAnTGACCT (11). Ating s monomer, the onserve DNA ining site of LRH1 is urrently efine s (/tcaagg/tcg/) (12, 13). In reent mouse wholegenome hromtinimmunopreipittion (ChIP) experiments remrkle enrihment of LRH1type ining sites ws etete in DNA sequenes preipitte with ntioies ginst FXR. FXR n LRH1 were foun to synergistilly inue trnsription of mouse Shp (14). In line with these oservtions, funtionl LRH1 ining sites hve een ientifie in severl genes tht re lso ontrolle y FXR/RXRα, inluing BSEP (2), SHP (6), orgni solute trnsporter lph/et (OSTα/β) (15) n ftty i synthse (FAS) (16, 17). FXR/RXRαmeite trnsriptionl ontrol is primrily regulte y their ligns, ile is (in prtiulr henoeoxyholi i (CDCA)) n 9is retinoi i (9RA), respetively. Erlier, we n others hve shown tht these ligns hve opposite effets on ining of FXR/RXRα to the IR1 n the resulting trnsriptionl tivity of the humn BSEP promoter (18, 19). FXR ligns (oth CDCA n GW4064) strongly inrese FXR/RXRαmeite expression of BSEP, while oministrtion of 9RA effetively represses this effet. 9RA strongly reue the ining of FXR/ RXRα to the IR1 sequenes s they re present in the humn BSEP n SHP promoters. In ontrst to the effet on BSEP expression, however, CDCA n 9RA synergistilly tivte SHP trnsription, in oth in vivo n in vitro experiments (19). This suggests tht the mehnisms y whih these ligns ontrol FXR/RXRαmeite regultion of BSEP n SHP my e funmentlly ifferent, while they re oth onsiere to e typil FXR/RXRα trget genes. Opposite effets of RXRα ligns on CDCAinue expression of FXR/RXRα trget genes hve een esrie y others lso (18, 20), ut the ifferentil mehnisms remin elusive so fr. Over the lst ee it hs eome evient tht the funtion of FXR n SHP is not restrite to ile i synthesis, ut tht these ftors lso ply role in liver regenertion, virl replition, tumor suppression, firogenesis, gluose n lipi metolism (21, 22). It is therefore highly relevnt to unerstn the moleulr mehnisms tht etermine the lignseletive regultion of FXR/RXRα trget genes, in prtiulr tht of SHP. Mteril n methos Cell Lines n Culture Conitions HepG2.rNtp n DLD1 ells were ulture in Duleo s moifie Egle meium (DMEM) or RPMI 1640, respetively, supplemente with lipistrippe serum (Bioser, Est Sussex, UK) s esrie previously (19, 23). HEK293 ells were ulture like HepG2 ells. Culture onitions for mrna n luiferse reporter ssys were esrie efore (19). Cells were expose to 100 µmol/l CDCA (CliohemNov 85

5 Chpter 3 iohem, Sn Diego, CA, USA) or 1 µmol/l GW4064 (Toris, Ellisville, USA) n/ or 1 µmol/l 9RA (Sigm Alrih, St. Louis, MO), s esrie in the text. A DLD1 ell line overexpressing hfxr (DLD1.hFXR) ws generte y stle trnsfetion of pdna3hfxr in DLD1. Trnsfetion HepG2.rNtp n HEK293 ells were trnsfete s esrie previously (4). DLD 1 ells were trnsfete using Trnsfetine (Bior, Herules, CA) t rtio of 3 µl Trnsfetine per µg DNA s reommene y the mnufturer. Expression plsmis of hfxr (pdna3hfxr) n hrxrα (psg5hrxr) were use t 200 ng n 100 ng, respetively, n luiferse reporter plsmis (pgl3si erivtives) t 1 µg per 9.6 m 2 well. If neee, totl mount of DNA ws juste with pcmv5 plsmi to 1.3 µg per well. Plsmis The 579p (569/10) hshp promoter onstrut in pgl3 si ws kin gift from Dr. S.M. Houten (Aemi Hospitl Amsterm, The Netherlns). pdna5mlrh1 ws kin gift from Dr. J. Hgemn (University Meil Center Groningen, The Netherlns) (24). The plsmis pdna3hfxr, psg5hrxr, pcmv5 n etils out their use hve een esrie (4, 19). SiteDirete Mutgenesis 5 trunte mutnts of the hshp promoter were me y PCR from the pgl3 hshp 569/10. pgl3 SHP 569/10 FXRE KO (6) ws generte vi siteirete mutgenesis y full vetor mplifition. Deletion mutnts lking intr promoter regions, FXRE nonsense mutnts n hlfsite nonsense mutnts were generte y mplifying the two iniviul promoter frgments flnking the region to e mutte or elete. Susequently, these two frgments were fuse y overlp PCR. PCR prouts were KpnI/BglIIligte into pgl3 si (Promeg, Mison, USA). Oligo s (Invitrogen, Pisley, UK) use to generte these SHP promoter mutnts re shown in Supplementry Tle 3.S1. Enotoxinfree plsmis were isolte (MhereyNgel, Düren, Germny) from E. oli Top10 ells (Invitrogen, Pisley, UK). All promoter onstruts were sequene (BseCler; Leien; The Netherlns) to ssure tht the orret muttions were introue. mrna Isoltion n QPCR mrna ws isolte from DLD1, HepG2.rNtp n HEK293 ells. RTqPCR ws performe s ws esrie efore (25). Sequenes of the primer/proe sets re shown in Supplementry Tle 3.S2. Luiferse Reporter Assys Cells were lyse in 500 µl pssive lysis uffer (Promeg, Mison, USA). After entrifugtion, 20 µl of the superntnt ws use to etermine luiferse tivity in 86

6 FXR Regultes SHP Expression Through LRE, Inepenent of n IR1 n LRH1 MPL1 Miroplte Luminometer (Berthol Detetion Systems). Using 50 µl luiferse sustrte (Promeg, Mison, USA), ely time set to 2.05 seons n mesuring time set to 10 seons. FXR PullDown Assy An FXR pull own ssy ws performe s esrie efore (19) on nuler extrt of DLD1 ells tht stly expresse hfxr (DLD1.hFXR), trete for 24 hours with CDCA. 68p iotinlele DNA proes ontining the wil type 122/69 (GG GGCAATGTCTGTGTGTTTTTTTCAATGAACATGACTTCTGGAGTCAAGGT TGTTGGGCCATTCCCC; the puttive LRH1 ining site is inite in itli) n mutte 122/69 (GGGGCAATGTCTGTGTGTTTTTTTCAATGAACATG ACTTCTGGAGTCATTAATTTTGGGCCATTCCCC; the mutte positions within the puttive LRH1 ining site re unerline) region were use to preipitte FXR. Biotinlele DNA proes ontining frgment of the BSEP promoter inluing the IR1 (TGTCACTGAACTGTGCTTGGGCTGCCCTTAGGGACATTGATCCT TAGGCAAAT; the IR1 is inite in itli) or frgment of the LI promoter (GTAGTGGCGAAATTGTGAGCGCTCACAATTCGTTTGGCCG) were use s positive n negtive ontrols, respetively. Nuler extrts were preinute (1h t 4 C) with 3fol exess of unlele wil type 122/54, mutte 122/54, BSEPIR1 (CCCTTAGGGACATTGATCCTTAGG; the IR1 is inite in itli) or LI DNA proes in ompetition experiments. FXR ining ws nlyze y western lotting, using ntifxr (PPA9033A00; Perseus, Jpn), expose in Chemi Do XRS system n quntifie using the Quntity One softwre pkge (BioR, GmH, Munih, Germny). Sttistil Anlysis Dt re presente s men ± SD. Differenes etween onitions were etermine in SPSS y KrusklWllis followe y pirwise omprison of groups y MnnWhitney U with p Results The IR1 t 291/279 Is Lrgely Dispensle For FXRepenent Inution of the Humn SHP Promoter The RXRα lign 9RA lowers BSEP expression y inhiiting FXR/RXRα ining to the IR1 (18, 19), while trnsription of other FXR/RXRα trget genes (SHP, OSTβ, ilel ile i ining protein (IBABP), FGF19; see Supplementry Figure 3.S1) is superinue. Here, we performe etile nlysis of the humn SHP promoter to otin insight in the moleulr mehnisms y whih ile is n 9RA synergistilly inue trnsription of FXR/RXRα trget genes. The 569/10 SHP promoter element esrie erlier (6) showe the sme pttern of regultion y CDCA n 9RA s oserve for genomi SHP (Figure 3.1 n Supplementry Figure 3.S1). 87

7 Chpter 3 Humn SHP promoter vrints Reltive promoter tivity Lu * 303 Lu * 278 Lu 303 Lu 303 Lu 303 Lu vehile 9RA CDCA CDCA/9RA Construt Sequene Wil type 303 CTGGTACAGCCTGAGTTAATGACCTTGTTTA 272 IR1 KO 303 CTGGTACAGCCTGAAATAATGTACTTGTTTA 272 IR1 NS 303 CTGGTACAGCCTAGAGAGAGAGAGATGTTTA 272 IR1 DEL 303 CTGGTACAGCCT...TGTTTA 272 Figure 3.1. The IR1 t 291/279 is require for 9RA, ut not for CDCAmeite inution of the humn SHP promoter DLD1 ells were trnsfete with hfxr n hrxrα expression plsmis n vrious hshp promoter onstruts s inite. Cells were trete with or without 100 µmol/l CDCA n/or 1 µmol/l 9RA. The synergisti effet of the FXR lign (CDCA) n RXRα lign (9RA) on SHP promoter tivity epens on the previously ientifie IR1 lote t 291/279. Muttion or eletion of this IR1 sequene i not olish SHP promoter tivtion y FXR/CDCA. Luiferse tivity ws mesure to etermine the SHP promoter tivity. Dt re presente s men ± SD; n 3. CDCA trete onitions re set to 100. P 0.05 for *) in pirwise omprison y MnnWhitney U test. CDCA tretment resulte in 12fol inrese of the SHP promoter tivity n this ws superinue y 9RA (45% to 17fol inution ompre to untrete ells). An FXRE/IR1 ws previously ientifie t position 291/279 in the SHP promoter (57). As expete, 5 trunte SHP promoter element up to position 303 (303/10) retine the CDCAinution (9.8fol) n 9RA superinution (43% to 14fol) hrteristis. Further 5 shortening of the SHP promoter element to 278/10 (eleting the IR1) le to the loss of 9RA superinution. Remrkly, the CDCAinution of the 278/10 SHP promoter element remine intt (8.1fol; Figure 3.1). Disrupting the IR1 sequene in the 303/10 promoter element (y n IR1 knok out muttion (KO) (6), replement y nonsense sequene (NS) or full eletion (DEL)) le to the sene of 9RA superinution, 88

8 FXR Regultes SHP Expression Through LRE, Inepenent of n IR1 n LRH1 ut mintine the CDCAinution (Figure 3.1), even in the ontext of the lrger 569/10 SHP promoter element (Supplementry Figure 3.S2). These t inite tht the 9RAmeite tivtion of the humn SHP promoter epens on the IR1 sequene t position 291/279. However, this sequene is (lrgely) ispensle for the CDCAinue tivity. This ltter fining ws highly surprising n prompte us to stuy this in further etil. CDCAinue Ativtion of the 278/10 SHP Promoter Elements Depens on FXR The CDCAinue tivtion of the 278/10 SHP promoter element ws omprle to the 303/10 SHP element (8.1fol vs. 9.8fol, respetively) n ws fully epenent on the presene of FXR (Figure 3.2). The FXR/CDCAinution ws lost when the SHP promoter ws reue to miniml element of 69/10. This inites tht the 278/69 region in the humn SHP promoter ontins yet unientifie sequene tht is essentil for FXR/CDCAepenent regultion. 569 Humn SHP promoter vrints Lu CDCA FXR Reltive promoter tivity 303 Lu * 278 Lu 278 Lu * * = IR1 69 Lu Figure 3.2. FXR is require for CDCAinue tivtion of the 278/10 SHP promoter DLD1 ells were trnsfete with hfxr n hrxrα expression plsmis n vrious hshp promoter onstruts s inite. Cells were trete with or without 100 µmol/l CDCA. Luiferse tivity ws mesure to etermine the SHP promoter tivity. Dt re presente s mens ± SD; n 3. P 0.05 for *) in pirwise omprison y MnnWhitney U test. The Novel FXR/CDCAresponsive Element Is Lote in the 122/69 Region of the SHP Promoter Two frgments (203/122 or 122/69) were elete from the 303/10 n the 278/10 SHP promoter elements to elinete the region involve in the regultion y FXR/RXRα/CDCA (Figure 3.3A). Deletion of the 122/69 frgment from the 278/10 SHP promoter element me it unresponsive to FXR/RXRα/CDCA, while eletion of the 203/122 i not reue the FXR/RXRα/CDCAtivtion. Importntly, the 122/69 eletion lso strongly reue the FXR/RXRα/CDCAtivtion of the IR1ontining 303/10 SHP promoter element (Figure 3.3B). Similr results were otine when FXR/RXRαtrnsfete ells were trete with the syntheti FXR lign GW4064 inste of CDCA (Figure 3.3C). The FXR/RXRα/CDCA n FXR/RXRα/GW4064inue regultion of the SHP promoter frgments ws most pronoune in intestinl DLD1 ells, ut ws lso oserve in hepti HepG2.rNtp n renl HEK293 ells (Figure 3.4). 89

9 Chpter 3 A 569 Humn SHP promoter vrints Lu Lu Lu Lu pgl3 hshp 569/10 pgl3 hshp 303/10 pgl3 hshp 303/10 el 203/122 pgl3 hshp 303/10 el 122/ Lu pgl3 hshp 278/ Lu Lu Lu pgl3 hshp 278/10 el 203/122 pgl3 hshp 278/10 el 122/69 pgl3 hshp 69/10 Symol Responsive element NR Position Referene FXRE (IR1) FXR 291/279 Goowin 2000 LXRE (DR4) LXRα 284/269 Goowin 2003 PPRE (DR1) PPARγ 90/78 Kim 2007 B Reltive CDCA inue promoter tivity C Reltive GW4064 inue promoter tivity 569/ CDCA GW /10 303/10 el 203/ /10 el 122/69,,,,,, 278/10 278/10 el 203/ /10 el 122/69,,,, 69/10,,,, Figure 3.3. An FXR/RXRα/CDCAresponsive element is lote in the 122/69 region of the SHP promoter A) shows n overview of the ifferent onstruts use to lolize the FXRresponsive element in the 278/69 region of the SHP promoter. Relevnt ining sites for other NRs re inlue. (B, C) DLD1 ells were trnsfete with the inite hshp promoter onstruts n expression plsmis for hfxr n hrxrα. Cells were trete with or without 100 μmol/l CDCA (B) or 1 μmol/l GW4064 (C). Luiferse tivity ws mesure to etermine SHP promoter tivity. Dt re presente s mens of ± SD; n 3. Signifint ifferenes re inite when ompre to CDCA/GW4064trete 569/10; CD CA/GW4064trete 303/10; CDCA/GW4064trete 278/10. P 0.05 in pirwise omprison y MnnWhitney U test. These t inite tht the 122/69 sequene is ruil for FXRepenent regultion of the SHP promoter. The previously ientifie IR1 t position 291/279 ontriutes only to minor exten to the FXRepenent regultion of SHP. 90

10 FXR Regultes SHP Expression Through LRE, Inepenent of n IR1 n LRH1 A Reltive promoter tivity B Reltive promoter tivity CDCA GW /10,, 303/10 278/10 303/10 el 122/69,, DLD1 HEK 293 HepG2rNtp,, DLD1 HEK 293 HepG2rNtp Figure 3.4. The 122/69 region is require for optiml FXRlignmeite inution of the SHP promoter in DLD1, HEK293 n HepG2 ells The olon rinom (DLD1), humn emryoni kiney (HEK293) n heptom (HepG2.rNtp) ell lines were trnsfete with the inite hshp promoter onstruts n expression plsmis for hfxr n hrxrα. Cells were trete with or without 100 μmol/l CDCA (A) or 1 μmol/l GW4064 (B). Luiferse tivity ws mesure to etermine SHP promoter tivity. Dt re presente s men of ± SD; n 3. Promoter tivity in CDCA/GW4064trete onition is signifintly ifferent from the 278/10 onstrut in DLD1, HEK293 or HepG2.rNtp ells. P 0.05 in pirwise omprison y MnnWhitney U test. An LRH1 Site Is Require for the FXRDepenent Inution of Humn SHP The 122/69 region from the SHP promoter ws sreene for puttive nuler reeptor ining sites. An IR1like sequene is etete t 118/106 (AtGTCtgTGtgtT) with 7 out of 12 IR1 onsensus nuleoties. Alterntively, FXRregultion my t through previously ientifie DR1/PPARγ ining site t position 90/78 (26) s it lso ontins the ore TGACCT sequene. In ition, this region ontins ining site for LRH1 (TCAAGGTTG t 79/71). Siteirete muttions were introue in these 3 regions. While muttions in the IR1like n DR1 sites only slightly reue FXRmeite inution of SHP promoter tivity, it ws lmost ompletely rogte when the LRH1 site ws mutte (Figure 3.5). Previously, it ws suggeste tht FXR n LRH1 my synergistilly inue expression of murine Shp (14). While the humn SHP promoter tivity ws oseepenently inue y oexpression of mlrh1, onfirming the presene of funtionl LRH1 site, it i not enhne the FXR/CDCAinue tivity of the SHP promoter (Figure 3.6). In ft, t high oses, LRH1 rther represses FXR/CDCAtivtion of the 303/10 hshp promoter element. Similr results were otine for the 569/10 hshp promoter (Supplementry Figure 3.S3). In ition, CDCA tretment of FXR/RXRαtrnsfete DLD1 ells i not inue LRH1 expression (Supplementry Figure 3.S4). Colletively, these t inite tht the FXRmeite inution of humn SHP is inepenent of LRH1, ut requires the LRH1 ining site. 91

11 Chpter 3 A Sequene 122\69 WT 122 GGCAATGTCTGTGTGTTTTTTTCAATGAACATGACTTCTGGAGTCAAGGTTGT 69 ATGTCTnTGTGTT (118/106) TGACTTnTGGAGT (90/78) LRH1 site (79/71) TCAAGGTTG mut118/ GGCATTTATTGTGTGTTTTTTTCAATGAACATGACTTCTGGAGTCAAGGTTGT 69 mut110/ GGCAATGTCTGTTAAATTTTTTCAATGAACATGACTTCTGGAGTCAAGGTTGT 69 mut90/ GGCAATGTCTGTGTGTTTTTTTCAATGAACAATTAATCTGGAGTCAAGGTTGT 69 mut83/ GGCAATGTCTGTGTGTTTTTTTCAATGAACATGACTTCCAGAGTCAAGGTTGT 69 mut75/ GGCAATGTCTGTGTGTTTTTTTCAATGAACATGACTTCTGGAGTCATTAATTT 69 B 278/10 WT CDCA Reltive promoter tivity /10 mut118/ /10 mut110/ /10 mut90/86 * * 278/10 mut83/82 C 278/10 mut75/70 569/10 WT CDCA * Reltive promoter tivity /10 mut75/70, 569/10 IR1 KO 569/10 IR1 KO mut75/70, Figure 3.5. The LRH1 site is require for FXRinue expression of SHP (A) shows the lotion of IR1like hlf sites n n LRH1 site in the 122/69 region of the hshp promoter. The ltter ws previously ientifie in the murine Shp promoter (34) n onserve in rt n humn (see Supplementry Figure 3.S5). All 4 IR1like sites n the LRH1 site were mutte n nlyze for the effet on FXR/CDCAmeite inution of the 278/10 hshp promoter (B) mutting one of the IR1 hlfsites i not or only prtilly reue FXR/CDCAepenent tivtion of the 278/10 hshp promoter frgment, wheres muttions in the LRH1 site strongly reue the response of the 278/10 hshp promoter frgment to FXR/CDCAstimultion. *) signifintly ifferent from CDCA trete 278/10 WT (C) in the ontext of the 569/10 hshp promoter frgment the LRH1 site is the ominnt FXR/CDCA response element (over the previously ientifie IR1). DLD1 ells were trnsfete with hfxr n hrxrα expression plsmis n vrious hshp promoter onstruts s inite. Cells were trete with or without 100 µmol/l CDCA. Luiferse tivity ws mesure to etermine the SHP promoter tivity. signifintly ifferent from CDCA trete 569/10 WT. signifintly ifferent from CDCA trete 569/10 IR1 KO. Dt presente s mens ± SD; n 3. P 0.05 for *), n in pirwise omprison y MnnWhitney U test. 92

12 FXR Regultes SHP Expression Through LRE, Inepenent of n IR1 n LRH1 mlrh1 (ng) Reltive promoter tivity vehile FXR/RXR FXR/RXR CDCA Figure 3.6. No synergy etween FXR n LRH1 in humn SHP regultion LRH1 oseepenently inue tivtion of the 303/10 hshp promoter frgment, onfirming the presene of funtionl LRH1 responsive element. In the presene of FXR similr ose response urve is oserve. However, in the presene of CDCA, FXR n LRH1 o not synergistilly tivte the SHP promoter. LRH1 rther limits the FXR/CDCAepenent tivtion t higher ose. DLD1 ells were trnsfete with hfxr n hrxrα expression plsmis, the 303/10 hshp promoter onstrut n/or inresing mounts of n mlrh1 expression plsmi s inite. Cells were trete with or without 100 µmol/l CDCA. Luiferse tivity ws mesure to etermine the SHP promoter tivity. signifintly ifferent from 0 ng mlrh1 vehile, etween vehile trete onitions. signifintly ifferent from 0 ng mlrh1 FXR/RXR, etween FXR/RXR trete onitions. Dt presente s men ± SD; n 3. P 0.05 for n in pirwise omprison y MnnWhitney U test. FXR Physilly Bins to the LRH1 Site in the 122/69 Region of the Humn SHP promoter Next, we nlyze whether FXR ins iretly to the 122/69 region in the humn SHP promoter y pplying n FXRpull own ssy (19) using iotinlele 68p DNA frgment ontining the 122/69 region of the SHP promoter. This SHP promoter frgment effiiently preipitte FXR from nuler extrts of CDCAtrete DLD1 ells tht stly overexpress hfxr (DLD1.hFXR), similr s the positive ontrol (BSEPIR1) i (Figure 3.7A). Bining of FXR ws rogte when the LRH1 site ws mutte in the 122/69 element. Moreover, the mutte sequene i not ompete for FXR ining, while the wil type 122/69 SHP promoter frgment i (Figure 3.7A n B). Tken together, these t show tht FXRmeite expression of humn SHP is lrgely ontrolle vi iret ining of FXR to newlyientifie DNA sequene tht inlues n LRH1 ining site t position 79/71. Disussion In this stuy, we show tht FXR regultes humn SHP expression primrily vi iret ining to n LRH1 site n not the previously ientifie IR1. No synergism ws etete etween FXR n LRH1 in regultion of humn SHP. In ontrst, the IR1 sequene ws require for 9RAinue expression of SHP. This is the first inepth nlysis of the ostimultory trnsriptionl regultion y the ligns of FXR n RXRα, CDCA n 9RA. This mehnism is funmentlly ifferent from FXR/ RXRαmeite regultion of BSEP tht ts through n IR1 (4). Sequening of DNA frgments tht in FXR in the mouse genome hs reently revele tht inee the IR1 is the most prominent ining site of this trnsription 93

13 Chpter 3 A Pull own proe FXR IR1 LI SHP122/69 EB ompetitor IR1 LI Quntifition B SHP122/69 Pull own proe EB LI IR1 Mut WT WT WT FXR ompetitor WT Mut 94 Quntifition Figure 3.7. FXR ins to the LRH1 responsive element in the hshp promoter FXR ws preipitte from nuler extrts of hfxroverexpressing DLD1 ells using DNA proe ontining the SHP 122/69 region ( wil type (WT) or mutte (mut)), the IR1 from the hbsep promoter (positive ontrol), the LI ining site (negtive ontrol) or empty es (EB, negtive ontrol). A) DNA proes of SHP 122/69 n BSEPIR1 in FXR. Competition experiments were performe with 3fol exess hbsepir1 or LI lking iotin lel. B) the SHP 122/69 region with mutte LRH1 site file to preipitte or ompete for FXR ining. Competition experiments were performe with 3fol exess wil type SHP 122/69, mutte SHP 122/69 or LI lking iotin lel. ftor (14, 27, 28). Notly, the IR1 in the mouse, rt n humn SHP promoters evite from the experimentlly estlishe IR1 onsensus t lest t one ruil position (GAGTTATGACCT, where the unerline T in the SHP IR1 is G or C in the onsensus IR1). The seon most enrihe FXRining sequene in the genomewie hromtin immunopreipittion experiments ppere to onfirm to n LRH1 ining site tht is in lose proximity to the IR1. Cotrnsfetion experiments revele synergisti effet of FXR/RXR n LRH1 on the tivity of the Shp promoter (14). Our t show tht 1) FXRmeite expression of humn SHP is lrgely inepenent of the IR1, 2) LRH1 oes not enhne FXR/RXRαinue SHP promoter tivity, 3) FXR is preipitte with DNA frgment ontining the LRH1 site, whih is rogte when this site is mutte; 4) FXRmeite inution of SHP promoter lking n IR1 is similr in ells without enogenous LRH1 (HEK293) n in ells tht ontin intermeite (DLD1) or high levels of LRH1 (HepG2.rNtp). This suggest tht FXRmeite regultion oes not epen on the presene of LRH1, whih is in line with the oservtion tht GW4064inue Shp mrna expression in mouse liver ws hrly ffete y the sene of Lrh1 (29). Most surprising ws the ft tht the IR1 ws extrneous for FXRmeite inution of the hshp promoter, ut require ownstrem sequene tht hrors n LRH 1 ining site. The miniml LRH1 ining site ws, however, not suffiient to in signifint mounts of FXR in pullown ssys (t not shown), suggesting tht sequenes flnking the LRH1 ining site re require for effiient FXR ining.

14 FXR Regultes SHP Expression Through LRE, Inepenent of n IR1 n LRH1 This is orroorte y the oservtion tht muttions in the 122/69 region outsie the LRH1 onsensus sequene lso reue the FXRinue SHP promoter tivity, though this ws less pronoune thn the muttions in the LRH1 site. Tken together, we onlue tht the LRH1 site in the humn SHP promoter is most importnt site for FXRmeite expression. Importntly, this novel FXR ining site is fully onserve in the humn, mouse n rt SHP/Shp promoters (Supplementry Figure 3.S5). Another remrkle fining ws tht the previously ientifie IR1 ws tully require for 9RAinue expression of SHP. Previously, it hs een shown tht the IR1 overlps with n LXRα/RXRα DR4 response element t 284/269 (30). The syntheti lign RXRα ws shown to e potent tivtor of LXR/RXRαinue trnsriptionl tivity, even more so thn the LXRα lign T Thus, it is very well possile tht 9RA inues SHP expression through LXR/RXRα. In ition, the IR1 lso ontins puttive DR2 sequene (Supplementry Figure 3.S6). RXRα homoimers n RXRα/RAR heteroimers hve een shown to in DR2 elements (31). SHP promoter tivity ws inee inue y 9RAtivte RXRα, whih ws not ffete y otrnsfetion with RAR (t not shown). So, lterntively, 9RA my t vi RXRα homoimers y ining the DR2 in the 291/279 region in the SHP promoter. At present it is unknown how ommon this lterntive pthwy of FXRmeite trnsription through LRH1(like) sequenes is. The FXR/CDCAinue tivity vi the LRH1 site is insensitive to 9RA. Together with the ft tht the IR1 is require for the 9RAmeite inution of SHP this provies the first moleulr mehnism explining how these ligns (9RA n CDCA) le to mximum inution of trnsription, leit vi two inepenent sites. Mximum expression fter exposure to oth ligns ws lso oserve for OSTβ, IBABP, FGF19 n others oserve this for phospholipi trnsfer protein (PLTP) (32) n sulfotrnsferse 2A1 (SULT2A1/STD) (33). In ontrst, OSTα showe BSEPlike pttern (9RA loks CDCAinue expression). Sine 9RA ws foun to reue ining of FXR/RXRα to the IR1 sequene (s present in the humn BSEP n SHP promoter), the IR1 ontining promoters of OSTβ, IBABP n FGF19 nee to hror ompenstory mehnism tht ultimtely le to mximl trnsription with oth ligns. Our t ontrst to those previously reporte y Lu et l. (5) n Goowin et l. (6), who reporte tht the IR1 is essentil for FXRinue expression of humn SHP. We followe the sme experimentl pproh s these stuies. Most of our t ws generte using DLD1 ells, in whih we oserve the most roust FXRmeite inution of the SHP promoter. Still, we show tht the IR1 ws lso ispensle for FXRmeite inution of the SHP promoter in HEK293 n HepG2 ells, whih were use in the erlier stuies. A puttive explntion for these, seemingly opposite, oservtions my e tht oth the IR1 n the LRH1 site n in FXR n tivte SHP expression, ut tht their reltive ontriution my epen on the ellulr n/or nuler levels of FXR, RXRα n their ligns. These ftors my vry etween ell types, pssge numers n the experimentl onitions in these 3 stuies. 95

15 Chpter 3 The RXRα lign (9RA) my reue the ining of the FXR/RXRα heteroimer to the IR1 sequene n stimulte LXR/RXRα or RXRα homoimer ining in the 291/269 region. In ontrst, 9RA oes not ffet the FXRmeite regultion of SHP vi the 122/69 element. Physiologilly, this mintins SHPmeite regultion of ile slt synthesis (CYP7A) n ile slt import (NTCP, ASBT) inepenent of the vitmin A/9RA levels. In line with this, ile sltmeite inution of Shp ws mintine in vitmin Aefiient mie (19). In onlusion, our stuy revels for the first time moleulr mehnism of FXRtivte trnsription tht is not inhiite y the RXRα lign 9RA, whih is the most frequent moe of regultion oserve for FXRtrget genes. Surprisingly, this is meite through nonir1 FXR response element tht shows typil hrteristis of n LRH1 DNA ining onsensus. Aknowlegements The uthors woul like to thnk Dr. S. M. Houten (University of Amsterm, The Netherlns) n Dr. J. Hgemn (University of Groningen, The Netherlns) for the generous gifts of pgl3shp(569/10) n pdna5mlrh1, respetively. 96

16 FXR Regultes SHP Expression Through LRE, Inepenent of n IR1 n LRH1 Referenes 1. Nitt M, Ku S, Brown C, Okmoto AY, Shn B. CPF: n orphn nuler reeptor tht regultes liverspeifi expression of the humn holesterol 7αhyroxylse gene. Pro Ntl A Si U S A 1999;96: Song X, Kiml R, Yn B, Deng R. Liver reeptor homolog 1 trnsriptionlly regultes humn ile slt export pump expression. J Lipi Res 2008;49: Annthnrynn M, Blsurmnin N, Mkishim M, Mngelsorf DJ, Suhy FJ. Humn ile slt export pump promoter is trnstivte y the frnesoi X reeptor/ile i reeptor. J Biol Chem 2001;276: Plss JR, Mol O, Heegsm J, Geuken M, Fer KN, Jnsen PL, et l. Frnesoi X reeptor n ile slts re involve in trnsriptionl regultion of the gene enoing the humn ile slt export pump. Heptology 2002;35: Lu TT, Mkishim M, Rep JJ, Shoonjns K, Kerr TA, Auwerx J, et l. Moleulr sis for feek regultion of ile i synthesis y nuler reeptors. Mol Cell 2000;6: Goowin B, Jones SA, Prie RR, Wtson MA, MKee DD, Moore LB, et l. A regultory se of the nuler reeptors FXR, SHP1, n LRH1 represses ile i iosynthesis. Mol Cell 2000;6: Chen W, Owsley E, Yng Y, Stroup D, Ching JY. Nuler reeptormeite repression of humn holesterol 7αhyroxylse gene trnsription y ile is. J Lipi Res : Denson LA, Sturm E, Ehevrri W, Zimmermn TL, Mkishim M, Mngelsorf DJ, et l. The orphn nuler reeptor, shp, meites ile iinue inhiition of the rt ile i trnsporter, ntp. Gstroenterology 2001;121: Holt JA, Luo G, Billin AN, Bisi J, MNeill YY, Kozrsky KF, et l. Definition of novel growth ftorepenent signl se for the suppression of ile i iosynthesis. Genes Dev 2003;17: Song KH, Li T, Owsley E, Strom S, Ching JY. Bile is tivte firolst growth ftor 19 signling in humn heptoytes to inhiit holesterol 7αhyroxylse gene expression. Heptology 2009;49: Formn BM, Gooe E, Chen J, Oro AE, Brley DJ, Perlmnn T, et l. Ientifition of nuler reeptor tht is tivte y frnesol metolites. Cell 1995;81: Lu TT, Rep JJ, Mngelsorf DJ. Orphn nuler reeptors s elixirs n FiXeRs of sterol metolism. J Biol Chem 2001;276: Ue H, Sun GC, Murt T, Hirose S. A novel DNAining motif uts the zin finger omin of inset nuler hormone reeptor FTZF1 n mouse emryonl long terminl repetining protein. Mol Cell Biol 1992;12: Chong HK, Infnte AM, Seo YK, Jeon TI, Zhng Y, Ewrs PA, et l. Genomewie interrogtion of hepti FXR revels n symmetri IR1 motif n synergy with LRH1. Nulei Ais Res 2010;38: Frnkenerg T, Ro A, Chen F, Hywoo J, Shneier BL, Dwson PA. Regultion of the mouse orgni solute trnsporter lphet, OstαOstβ, y ile is. Am J Physiol Gstrointest Liver Physiol 2006;290:G912G Mtsukum KE, Bennett MK, Hung J, Wng L, Gil G, Osorne TF. Coorinte ontrol of ile is n lipogenesis through FXRepenent regultion of ftty i synthse. J Lipi Res 2006;47: Mtsukum KE, Wng L, Bennett MK, Osorne TF. A key role for orphn nuler reeptor liver reeptor homologue1 in tivtion of ftty i synthse promoter y liver X reeptor. J Biol Chem 2007;282: Kssm A, Mio B, Young PR, Mukherjee R. Retinoi X reeptor (RXR) gonistinue ntgonism of frnesoi X reeptor (FXR) tivity ue to sene of otivtor reruitment n erese DNA ining. J Biol Chem 2003;278: Hoeke MO, Plss JR, Heegsm J, Geuken M, vn Rijsergen D, Bller JF, et l. Low retinol levels ifferentilly moulte ile sltinue expression of humn n mouse hepti ile slt trnsporters. Heptology 2009;49:

17 Chpter Ci SY, He H, Nguyen T, Mennone A, Boyer JL. Retinoi i represses CYP7A1 expression in humn heptoytes n HepG2 ells y FXR/RXRepenent n inepenent mehnisms. J Lipi Res 2010;51: Chn D, Prk JH, Choi HS. Moleulr sis of enorine regultion y orphn nuler reeptor Smll Heteroimer Prtner. Enor J 2008;55: Wng YD, Chen WD, Moore DD, Hung W. FXR: metoli regultor n ell protetor. Cell Res 2008;18: Dijkstr G, Blokzijl H, Bok L, Homn M, Vn Goor H, Fer KN, et l. Opposite effet of oxitive stress on inuile nitri oxie synthse n hem oxygense1 expression in intestinl inflmmtion: ntiinflmmtory effet of ron monoxie. J Pthol 2004;204: Out C, Hgemn J, Bloks VW, Gerrits H, Sollewijn Gelpke MD, Bos T, et l. Liver reeptor homolog1 is ritil for equte upregultion of Cyp71 gene trnsription n ile slt synthesis uring ile slt sequestrtion. Heptology 2011;53: Blokzijl H, Vner Borght S, Bok LI, Lireht L, Geuken M, vn en Heuvel FA, et l. Derese Pglyoprotein (Pgp/MDR1) expression in inflme humn intestinl epithelium is inepenent of PXR protein levels. Inflmm Bowel Dis 2007;13: Kim HI, Koh YK, Kim TH, Kwon SK, Im SS, Choi HS, et l. Trnsriptionl tivtion of SHP y PPARgmm in liver. Biohem Biophys Res Commun 2007;360: Thoms AM, Hrt SN, Kong B, Fng J, Zhong XB, Guo GL. Genomewie tissuespeifi frnesoi X reeptor ining in mouse liver n intestine. Heptology 2010;51: Lee J, Mi SS, Yu P, Kim K, Smith Z, RivsAstroz M, et l. Genomi nlysis of hepti frnesoi X reeptor (FXR) ining sites revels ltere ining in oesity n iret gene repression y FXR. Heptology 2012 Jul;56(1): Lee YK, Shmit DR, Cummins CL, Choi M, Peng L, Zhng Y, et l. Liver reeptor homolog1 regultes ile i homeostsis ut is not essentil for feek regultion of ile i synthesis. Mol Enorinol 2008;22: Goowin B, Wtson MA, Kim H, Mio J, Kemper JK, Kliewer SA. Differentil regultion of rt n humn CYP7A1 y the nuler oxysterol reeptor liver X reeptorlph. Mol Enorinol 2003;17: Cstelein H, Jnssen A, Delerq PE, Bes M. Sequene requirements for high ffinity retinoi X reeptorlph homoimer ining. Mol Cell Enorinol 1996;119: Urizr NL, Dowhn DH, Moore DD. The frnesoi Xtivte reeptor meites ile i tivtion of phospholipi trnsfer protein gene expression. J Biol Chem 2000;275: Song CS, Ehhg I, Bek BS, Ahn SC, Oh T, Roy AK, et l. Dehyroepinrosterone sulfotrnsferse gene inution y ile i tivte frnesoi X reeptor. J Biol Chem 2001;276: Lee YK, Prker KL, Choi HS, Moore DD. Ativtion of the promoter of the orphn reeptor SHP y orphn reeptors tht in DNA s monomers. J Biol Chem 1999;274:

18 Supplementry Dt Supplementry Tle 3.S1 Oligo s use to rete mutnt onstruts of the hshp 569/10 promoter Primer Purpose Sequene Outer primers in pgl3 si Fw Amplify omplete insert CTAGCAAAATAGGCTGTCCC (RVprimer3) Rev Amplify omplete insert CCGAGTGTAGTAAACATTCC Site irete mutgenesis y full vetor mplifition Fw FXRE KO GTACAGCCTGAAATAATGTACTTGTTTATCCACTTGAGTCA Rev FXRE KO GATAAACAAGTACATTATTTCAGGCTGTACCAGGGCACC Truntion (primers ontin KpnI site) Fw Trunte to 303 CCTTGGTACCCTGGTACAGCCTGAGTTAAT Fw Trunte to 278 AGTTAAGGTACCTGTTTATCCACTTGAGTCAT Fw Trunte to 122 TCCTGGTACCGGCAATGTCTGTGTGTTTTT Fw Trunte to 69 TCAAGGTACCTGGGCCATTCCCCCCGTTCC Overlp PCR primers Fw nonsense FXRE ACAGCCTAGAGAGAGAGAGATGTTTATCCACTTGAGTCAT Rev nonsense FXRE ATAAACATCTCTCTCTCTCTAGGCTGTACCAGGGCACCAA Fw elete FXRE TTGGTGCCCTGGTACAGCCTTGTTTATCCACTTGAGTCAT Rev elete FXRE ATGACTCAAGTGGATAAACAAGGCTGTACCAGGGCACCAA Fw elete 203/122 CTGTGCCCTGCACCGGCCACGGCAATGTCTGTGTGTTTTT Rev elete 203/122 AAAAACACACAGACATTGCCGTGGCCGGTGCAGGGCACAG Fw elete 122/69 TCCCCACCATTCCTGCCAGGTGGGCCATTCCCCCCGTTCC Rev elete 122/69 GGAACGGGGGGAATGGCCCACCTGGCAGGAATGGTGGGGA Fw mut118/114 CACCATTCCTGCCAGGGGCATTTATTGTGTGTTTTTTTCAATGAAC Rev mut118/114 GTTCATTGAAAAAAACACACAATAAATGCCCCTGGCAGGAATGGTG Fw mut110/107 CCTGCCAGGGGCAATGTCTGTTAAATTTTTTCAATGAACATGACTT Rev mut110/107 AAGTCATGTTCATTGAAAAAATTTAACAGACATTGCCCCTGGCAGG Fw mut90/86 TGTGTTTTTTTCAATGAACAATTAATCTGGAGTCAAGGTTGTTGGG Rev mut90/86 CCCAACAACCTTGACTCCAGATTAATTGTTCATTGAAAAAAACACA Fw mut83/82 TTTTCAATGAACATGACTTCCAGAGTCAAGGTTGTTGGGCCATTCC Rev mut83/82 GGAATGGCCCAACAACCTTGACTCTGGAAGTCATGTTCATTGAAAA Fw mut75/70 GAACATGACTTCTGGAGTCATTAATTTTGGGCCATTCCCCCCGTTC Rev mut75/70 GAACGGGGGGAATGGCCCAAAATTAATGACTCCAGAAGTCATGTTC 99

19 Chpter 3 Supplementry Tle 3.S2. Tqmn primerproe sets use for RTqPCR Gene 18S BSEP/ABCB11 FGF19 IBABP LRH1/ NR5A2 OST lph OST et SHP/NR0B2 Oligo sequenes Fw: Rev: proe: Fw: Rev: proe: Fw: Rev: proe: Fw: Rev: proe: Fw: Rev: proe: Fw: Rev: proe: Fw: Rev: proe: Fw: Rev: proe: Proes were FAM TAMRA lele. 5 gg t t gg 3 5' tt ggg t g 3' 5'g g t t t g 3' 5 tg ttg g gg t tt3 5'gg ggt tg tg gg t3' 5' t gg gt gt t3' 5 tg t gt g tg3 5 g t tt t gt gg t t g3 5 tt ggg t gt3 5 g g g tt g t3 5 gg gt gtg tg gg gt g3 5 t tg tg t gtg 3 5 g g tt t ttg tgt t 3 5 gg tg gg g t t ggt 3 5 ggg g t tt g t tt 3 5 ggt gg g tg gg g3 5 tg gg gg tgt gg g gt3 5 ttt gt tg tt g gtt t t t 3 5 g gg tg tg g gg t3 5 g t gt tt t g 3 5 gt gtg g gt g tt tgg t t t3 5 gt g t tgt g t t 3 5 tt tg gg g g t gt3 5 t g g t gg g g3 100

20 Supplementry Dt A Reltive mrna levels versus 18S HepG2.rNtp vehile 9RA CDCA CDCA/9RA BSEP OSTα SHP OSTβ B Reltive mrna levels versus 18S DLD1 vehile 9RA CDCA CDCA/9RA OSTα IBABP SHP FGF19 OSTβ, Supplementry Figure 3.S1. Gene n ell typespeifi regultion of FXR/RXRα trget genes y 9RA HepG2.rNtp (A) n DLD1 (B) ells were trnsfete with expression plsmis for hfxr n hrxrα n trete with or without 100 µmol/l CDCA n/or 1 µmol/l 9RA. mrna levels of FXR trget genes were etermine y RTqPCR. Dt re orrete for 18S n isplye s mens ± SD; n 3. CDCA trete onitions re set to 100. Signifint ifferenes (p 0.05) re inite when ompre to untrete onition, 9RAtrete onition, CDCAtrete onition or CDCA/9RAtrete onition in pirwise omprison y MnnWhitney U test. FXRE wil type sequene CAGCCTGAGTTAATGACCTTGTTTA CDCA Reltive promoter tivity knok out CAGCCTGAAATAATGTACTTGTTTA * nonsense CAGCCTAGAGAGAGAGAGATGTTTA * elete CAGCCT...TGTTTA Supplementry Figure 3.S2. Intivtion of the IR1 t position 291/279 oes not olish FXR/ CDCAmeite inution of the 569/10 hshp promoter DLD1 ells were trnsfete with hfxr n hrxrα expression plsmis n the 569/10 SHP promoter onstruts. Cells were trete with or without 100 µmol/l CDCA. Luiferse tivity ws mesure to etermine the SHP promoter tivity. Dt presente s men ± SD; n 3. P 0.05 for *) in pir wise omprison y MnnWhitney U test. 101

21 Chpter 3 mlrh1 (ng) Reltive promoter tivity vehile FXR/RXR FXR/RXR CDCA Supplementry Figure 3.S3. No synergy etween FXR n LRH1 in humn SHP regultion LRH1 ose epenently inue tivtion of the 569/10 hshp promoter frgment, onfirming the presene of funtionl LRH1 responsive element. In the presene of FXR similr ose response urve is oserve. However, in the presene of CDCA, FXR n LRH1 o not synergistilly tivte the SHP promoter. LRH1 rther limits the FXR/CDCAepenent tivtion t higher ose. DLD1 ells were trnsfete with hfxr n hrxrα expression plsmis, the 569/10 SHP promoter onstrut n/or inresing mounts of the mlrh1 expression plsmi s inite. Cells were trete with or without 100 µmol/l CDCA. Luiferse tivity ws mesure to etermine the SHP promoter tivity. Dt presente s men ± SD. Reltive LRH1 mrna levels versus 18S FXR RXR CDCA Supplementry Figure 3.S4. FXR oes not inue LRH1 expression in DLD1 ells DLD1 ells were trnsfete with expression plsmis for hfxr n hrxrα n trete with or without 100 µmol/l CDCA. mrna levels of LRH1 were etermine y RTqPCR. Dt re orrete for 18S n isplye s men ± SD; n

22 Supplementry Dt mouse 337 CTGGTACAGCCTGGGTTAATGACCCTGTTTATGCACTTGAGTCATCCGATAAAGGGCATC 278 rt 328 CTGGTACAGCCTGGGTTAATAACCCTGTTTATACACTTGAGTCATCCGATAAAGGGCATC 269 humn 303 CTGGTACAGCCTGAGTTAATGACCTTGTTTATCCACTTGAGTCATCTGATAAGGGGCAGC 244 ************* ****** *** ******* ************* ***** ***** * mouse 277 CAGGCAGTGGGCAGGTGGCCCTGTGCCCTGCAATGGCCACTTCATTGACTAAAGTGATAG 218 rt 268 CAGGCAGTGGGCAGGTGGCCCTGTGCCCTGCAATGGCCACTTCATTGACTAAAGCGATAG 209 humn 243 TGAGTGAGCGGCAGGTGGCCCTGTGCCCTGCACCGGCCACTTCATTGACTGAGGTGATAT 184 * *********************** **************** * * **** mouse 217 CAAGGCCACGTGGAGCTTCCAGTGCCCCTCCCCCACCACTTCCCCATCAGTCCTGCCAG 159 rt 208 CAAGGCCACGTGGAGCTTCCAGTGCCCCTCCCCCACCACTTCTCCACCAGTCCTGCCAG 150 humn 183 CAGTGCCACGTGGGGTTCCCAATGCCCCCTCCCCCACCACTTCCCCACCATTCCTGCCAG 124 ** ********* * * *** ****** ************** *** ** ********* mouse 158 GGTCAGCGTGTATGCATTGTGTGTGTGTATGGTTTTTTTTTTTTTTTTCCTTTCAATGAA 99 rt 149 GGTCAGCGTGTATGCATTGTGTGTGTGTGTATGGTTTTTTTTTTTTTTTTCAATGAA 93 humn 123 GGGCAATGTCTGTGTGTTTTTTTCAATGAA 94 ** *** *** ******* **** ********* mouse 98 CATGACTTCTGGAGTCAAGGTTGTTTGGCCAGTCCCCTTCCCGCCCATCAAGGATATA 41 rt 92 CATGACTTCTGGAGTCAAGGTTGTTTGGCCAGTCCCCCTCCCGCCCATCAAGGATATA 35 humn 93 CATGACTTCTGGAGTCAAGGTTGTTGGGCCATTCCCCCCGTTCCACTCACTGGGAATATA 34 ************************* ***** ***** * ** * ** * ***** mouse 40 AATAGCACTCACAGTAGAGAGAGAGAGAGAGAGGGCCAGATAG 3 rt 34 AATAGCACTCCGTAGAGAGGGCCACAGAGCCAGGAAG 3 humn 33 AATAGCACCCACAGCGCAGAACACAGAGCCAGAGAG.3 ******** * ** * * **** **** ** Supplementry Figure 3.S5. Comprison of humn, mouse n rt SHP promoter sequenes The IR1 (itliol) is not fully onserve, wheres the LRH1 ining site (unerline) is fully onserve in the mouse, rt n humn SHP promoter. The 122/69 region is epite in ol. 300 DR4 DR2 GTACAGCCTGAGTTAATGACCTTGTTTATCCACTTGAGTCA IR1 260 Supplementry Figure 3.S6. The 9RA responsive element ommotes n IR1, n DR4 n puttive DR2 The IR1 (291/279) overlps with previously ientifie DR4 (Goowin et l., 2003; ins LXRα/ RXRα) n puttive DR2 (ins RXRα/RXRα n RXRα/RAR). 103

23