Supplementary Appendix

Size: px

Start display at page:

Download "Supplementary Appendix"

Duane Mills
5 years ago
Views:

1 Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Zucchero TM, Cooper ME, Maher BS, et al. Interferon regulatory factor 6 (IRF6) gene variants and the risk of isolated cleft lip or palate. N Engl J Med 2004;351:

2 Supplementary Figure 1 Summary of FBAT results for V274I in (A) Cleft Lip with or without Cleft Palate ( ANY LIP data subdivision) by population and (B) in Cleft Palate ( CP data subdivision) by population. The FBAT statistic (S), based on the proportion of parent-to-affected-child transmissions of the V allele, for each population subgroup is represented by the colored bars. Diamonds represent the expected value of S under the null hypothesis of Mendelian transmission (i.e., no association) and the horizontal bars identify the value of S at which p=0.05. A B

1 10 20 30 36 Supplementary Figure 2 Linkage disequilibrium plot generated using the GOLD program.

3 Supplementary Figure 2 Linkage disequilibrium plot generated using the GOLD program. LD values were calculated using genotypes generated for the 36 SNPs in the set of triads from the Philippines. The values represented by the colors are D values according to the scale shown on the right. An output of the values used to generate this plot are available in a separate table

4 Supplementary Table 1 Information about assays for SNPs in analyzed in this study. The SNPs in this list correspond to the arrows on the gene schematic in Figure 1 and are listed in order 5' to 3'. SNPs Marker Location in Region# Type of Assay Assay ID* 1 hcv kb 5' of IRF6 Assay-By-Design n/a 2 rs kb 5' of IRF6 Assay-By-Design n/a 3 hcv kb 5' of IRF6 Assay-By-Design n/a 4 rs kb 5' of IRF6 Assay-By-Design n/a 5 hcv kb 5' of IRF6 Assay-By-Design n/a 6 hcv kb 5' of IRF6 Assay-By-Design n/a 7 hcv kb 5' of IRF6 Assay-On-Demand C _10 8 hcv kb 5' of IRF6 Assay-On-Demand C _1 9 hcv kb 5' of IRF6 Assay-By-Design n/a 10 hcv kb 5' of IRF6 Assay-By-Design n/a 11 SNP 6 in IRF6 Assay-On-Demand C _1 12 SNP 9 in IRF6 Assay-By-Design n/a 13 SNP 10 in IRF6 Assay-By-Design n/a 14 SNP 12 in IRF6 Assay-By-Design n/a 15 SNP 13 in IRF6 Assay-On-Demand C _10 16 SNP 14 in IRF6 Assay-By-Design n/a 17 V274I in IRF6 Kinetic PCR see below 18 SNP 17 in IRF6 Assay-By-Design n/a 19 SNP 19 in IRF6 Assay-By-Design n/a 20 hcv kb 3' of IRF6 Assay-By-Design C _10 21 hcv kb 3' of IRF6 Assay-By-Design n/a 22 hcv kb 3' of IRF6 Assay-On-Demand C _1 23 hcv kb 3' of IRF6 Assay-By-Design n/a 24 hcv kb 3' of IRF6 Assay-By-Design n/a 25 hcv kb 3' of IRF6 Assay-By-Design n/a 26 hcv kb 3' of IRF6 Assay-By-Design n/a 27 rs kb 3' of IRF6 Assay-By-Design n/a 28 hcv kb 3' of IRF6 Assay-By-Design C _10 29 hcv kb 3' of IRF6 Assay-By-Design n/a 30 rs kb 3' of IRF6 Assay-By-Design n/a 31 hcv kb 3' of IRF6 Assay-By-Design n/a 32 hcv kb 3' of IRF6 Assay-By-Design n/a 33 hcv kb 3' of IRF6 Assay-By-Design n/a 34 hcv kb 3' of IRF6 Assay-By-Design n/a 35 hcv kb 3' of IRF6 Assay-On-Demand C _10 36 hcv kb 3' of IRF6 Assay-By-Design n/a #approximate location *for Assay-On-Demand assays. Target sequences for Assay-By-Design assays are available from authors upon request. for V274I: common primer sequence: CAGACCATGACCGTGAGCAA V-specific primer: TGCTCAGGACCTGGGAATTTGTC I-specific primer: TATGCTCAGGACCTGGGAATTTTAT

5 Supplementary Table 2 Allele frequencies for V274I polymorphism in worldwide ancestral populations. Allele counts and frequencies are provided for all individual populations included in the CEPH Diversity Panel. In addition, the overall allele counts and frequencies for some ethnic groups have been calculated by grouping individual populations together. Population Country # GG # GA #AA Total alleles # G alleles % G allele # A alleles % A alleles Biaka Pygmies Central African Republic Mbuti Pygmies Dem. Republic of Congo Mandenka Senegal Yoruba Nigeria Bantu NE Kenya San Namibia Bantu SE/SW South Africa Mozabite Algeria (Mzab) ALL AFRICA Bedouin Israel (Negev) Druze Israel (Carmel) Palestinian Israel (Central) Brahui Pakistan Balochi Pakistan Hazara Pakistan Makrani Pakistan Sindhi Pakistan Pathan Pakistan Kalash Pakistan Burnsho Pakistan ALL PAKISTAN Han China Tujia China Yizu China Miaozu China Oroqen China Daur China Mongola China Hezhen China Xibo China Uygur China Dai China Lahu China She China Naxi China Tu China ALL CHINA Yakut Siberia Japanese Japan Cambodian Cambodia Papuan New Guinea NAN Melanesian Bougainville French France French Basque France Sardinian Italy North Italian Italy (Bergamo) Tuscan Italy Orcadian Orkney Islands Adygei Russia Caucasus Russian Russia Pima Mexico Maya Mexico Colombian Colombia Karitiana Brazil Surui Brazil ALL NATIVE AMERICAN

6 Supplementary Table 3 Two-point linkage analysis of IRF6 V274I with oral-facial clefting and multipoint linkage analysis of IRF6 V274I and the Weber Screening Set 9 chromosome 1 markers with oral-facial clefting in extended kindreds from selected populations. TWO-POINT LINKAGE ANALYSIS Parametric LOD Scores 1 Nonparametric Birthplace Number of Recombination Fraction LOD score Families P-value India China Philippines Colombia Assuming a dominanassuming a recessiv Multipoint Nonmodel for clefting model for clefting parametric linkage Max Ch 1 multipoint Max Ch 1 multipoint Min Ch 1 IRF6 multipoint HLOD at multipoint HLOD at p-value p-value HLOD 2 IRF6 3 HLOD 2 IRF6 cm cm 5 India cm 208 cm 245 cm cm *=0.40 *=0.10 *=0.15 *=0.05 China cm 208 cm 293 cm 208 cm *=0.35 *=0.35 *=0.500 *=0.100 &268 cm Philippines cm 208 cm 89 cm 208 cm *=0.05 *=0.05 *=0.05 *= LOD scores presented are those calculated under a dominant model with reduced penetrance for each population. 2 Maximum multipoint HLOD on chromosome 1 with corresponding cm location and proportion of linked families (*). 3 Maximum multipoint HLOD at IRF6 with corresponding cm location and proportion of linked families (*). 4 Minimum multipoint nonparametric linkage value on chromosome 1 with corresponding cm location. 5 Multipoint nonparametric linkage p-value at IRF6.

7 Supplementary Table 4 FBAT values calculated from V274I genotypes for all the samples and the four ethnic subsets. Subset 1 = South America, Subset 2 = Asia, Subset 3 = Europe, Subset 4 = India Population Allele All affecteds CL CLP CP Any Lip Any Palate S E(S) p S E(S) p S E(S) p S E(S) p S E(S) p S E(S) p All samples n=731/3530 n=217/1091 n=470/2184 n=41/247 n=687/3275 n=511/2431 V < < < <10-9 I Subset 1 n=114/565 n=26/142 n=78/364 n=7/51 n=104/506 n=85/415 V I Subset 2 n=579/2227 n=170/620 n=382/1532 n=27/75 n=552/2152 n=409/1607 V < < < <10-9 I Subset 3 n=23/485 n=9/150 n=7/214 n=7/121 n=16/364 n=14/335 V I Subset 4 n=15/253 n=12/179 n=3/74 n/a n/a n/a V I

8 Supplementary Table 5 FBAT P-values for all SNPs in the IRF6 region analyzed in the Filipino and combined Iowa/Danish triads. Filipino Triads Danish and Iowa Triads SNPs Marker No. Triads p-value Associated Allele* SNP Marker No. Triads p-value Associated Allele* 1 hcv n/s 4 rs rs n/s 11 SNP n/s 3 hcv n/s 13 SNP n/s 4 rs n/s 15 SNP hcv n/s 17 V274I n/s 6 hcv n/s 29 hcv n/s 7 hcv rs n/s 8 hcv n/s 9 hcv n/s 10 hcv SNP n/s 12 SNP SNP n/s 14 SNP n/s 15 SNP SNP V274I SNP n/s 19 SNP hcv hcv n/s 22 hcv hcv n/s 24 hcv n/s 25 hcv hcv n/s 27 rs hcv hcv rs hcv n/s 32 hcv n/s 33 hcv n/s 34 hcv n/s 35 hcv n/s 36 hcv n/s * n/s = not significant; value for SNP 6 is borderline significant "No. triads" = number of informative triads for each SNP

9 Supplementary Table 6 Numeric values use to construct the linkage disequilibrium plot, specifically the D values in the last column. M1 M2 al1 al2 N df(0) df(1) ChiSq pvalue delta2 D'

Supplementary information for: Ancient west Eurasian ancestry in southern and eastern Africa

Supplementary information for: Ancient west Eurasian ancestry in southern and eastern Africa Joseph K. Pickrell 1,7,, Nick Patterson 2, Po-Ru Loh 3, Mark Lipson 3, Bonnie Berger 2,3, Mark Stoneking 4,