Single Nucleotide Variation in the TP53 3 Untranslated Region in Diffuse Large B-cell Lymphoma Treated with Rituximab-CHOP: A Report from the

Transcription

1 Supplementary Material for Single Nucleotide Variation in the TP53 3 Untranslated Region in Diffuse Large B-cell Lymphoma Treated with Rituximab-CHOP: A Report from the International DLBCL Rituximab-CHOP Consortium Program Study Table of Contents Supplemental Materials and Methods...2 Figure S1 Kaplan-Meier estimates of OS and PFS in DLBCL patients classified according to the presence of CDS mutations and of 3 UTR SNPs in the TP53 gene....5 Figure S2 Kaplan-Meier estimates of OS and PFS in DLBCL patients classified according to the presence of CDS mutations and of 3 UTR SNVs in the TP53 gene...6 Figure S3 Kaplan-Meier estimates of OS in DLBCL patients classified according to the status of the TP53 gene and gene expression profiling...7 Table S1 TP53 gene status in 244 patients...8 Table S2 Clinical and biological characteristics of 244 DLBCL patients and their impact on OS and PFS 14 Table S3 3 UTR variants in the second group of patients (n=247)...16 Table S4 Frequency of recurrent SNVs in the TP53 3 UTR in the combined group of 491 DLBCL patients...22 Table S5 The association of p53 protein expression and 3 UTR nsnvs in 244 patients...9 Table S6 Predicted deamination hotspots in the TP53 3 UTR

2 Supplemental Materials and Methods: Patients For the first group (n=244), patients were diagnosed with DLBCL between January 2002 and January Tumor specimens had been collected from all patients before therapy. Patients with transformation from low-grade lymphoma, those with primary mediastinal large B-cell lymphoma, and those with primary cutaneous or primary central nervous system DLBCL were excluded from our analysis due to their unique biological features. Patients with Epstein-Barr virus or HIV were also excluded. Treatment had consisted of R-CHOP (n=201, 82%) or an R-CHOP-like regimen (CHOP plus an anthracycline such as novantrone or epirubicin) (n=43, 18%). The median follow-up time was 36 months (range, 6-124). Responses had been assessed by CT scanning and bone marrow biopsy. For the validation set, tumor specimens were archived around the same time as those for the 506-patient cohort. Cell culture and plasmids H1299 cells were maintained at 37 C and 5% CO 2 in RPMI 1640 medium containing penicillinstreptomycin-amphotericin B and supplemented with 10% fetal bovine serum. For mutational analysis, the p53 expression vector pcmv-p53 (Clontech) was modified to contain TP and 3 UTRs. UTRs were generated via PCR using overlapping ~40mers as described elsewhere. 1 Mutant UTRs were generated by substitution of oligomers containing desired mutations for WT oligomers. Hind III and Xho I restriction sites were introduced to flank the 5 UTR and Eco RI and Sac II restriction sites were introduced to flank the 3 UTR to facilitate cloning into pcmv-p53. p53 expression and functional analyses in cells For all transfections, H1299 cells were seeded at 4.0 x 10 5 /well in 2mL of complete media in tissue culture treated 6-well plates (Becton Dickinson) and allowed to grow overnight to 70 80% confluence. Total plasmid DNA (750 ng 4 μg; 3:1 mirna:p53 expression vectors) was transfected using the Lipofectamine LTX & Plus reagent (Invitrogen) and incubated for 48 hrs. For Western blot analysis, cell lysates were prepared using 1x RIPA buffer (Cell Signaling) supplemented with Halt Protease and Phosphatase Inhibitor Cocktail (Thermo Scientific). Total protein concentration was determined with the BCA Protein Assay Kit (Pierce). Total protein (10 20 μg) was separated on precast 10% Mini- 2

3 PROTEAN TGX gels (Bio-Rad, Hercules, CA) and transferred to 0.2μm polyvinylidene difluoride (PVDF) membranes (Bio-Rad). Membranes were incubated with rabbit anti-p53 (#9282, Cell Signaling), mouse phospho-p53 (Ser-15; #9286, Cell Signaling), mouse anti-β-actin (Sigma) and appropriate secondary antibodies (Cell Signaling). Antigen-antibody complexes were detected with SuperSignal West Dura chemiluminescent substrate (Pierce). For Northern blot analysis, total RNA was isolated from H1299 cells harboring the TP53ExtWT or TP53ExtA 1175 C expression vector 24 hours post-transfection using the TRIzol reagent (Invitrogen) according to the manufacturer s instructions. Five to 10 μg of total RNA was fractionated on 1.5% formaldehyde agarose gels and transferred to a Zetaprobe membrane (Bio-Rad). Membranes were washed briefly at ambient temperature with 2XSSC (0.3M NaCl and 0.03M NaCitrate, ph 7.0) and 1% sodium dodecyl sulfate and prehybridized for 2 hours at 42 C with Rapid-Hyb buffer (GE Healthcare). The oligonucleotides used were: 5- AATGGAAGTCCTGGGTGCTTCTGA -3 (spanning exons 10 and 11 of p53 mrna) and 5- ATGGGCGGAGGAGAGTAGTCTG -3 (complementary to nucleotide of the RNA subunit of RNase P, H1RNA). The probes (30 pmol) were labeled with [γ- 32 P]ATP using the T4 polynucleotide kinase (New England Biolabs, Beverly, MA). Membranes were hybridized at 42 C overnight in Rapid- Hyb buffer and washed according to the manufacturer s instructions. Washed membranes were analyzed with Phosphorimager SF (Molecular Dynamics, Sunnyvale, CA). The TUNEL assay was performed using In Situ Cell Death Detection Kit, Fluorescein (Roche Applied Sciences; Indianapolis, IN). Statistical analysis All statistical calculations were performed using GraphPad Prism 5 (GraphPad Software, Inc.; La Jolla, CA). PFS was measured from the time of diagnosis to the time of progression or death from any cause. Late deaths that were not related to the lymphoma or its treatment were excluded in the PFS analysis. OS was measured from the time of diagnosis to last follow-up or to death from any cause. A Cox proportional-hazards model was used for multivariate analysis. Age 60 or less, Ann Arbor tumor stage I- II, normal lactate dehydrogenase level, good performance status, 0-1 extranodal sites, low or intermediate-low International Prognostic Index (IPI), GCB subtype, and WT TP53 CDS all predicted longer survival by univariate analysis, in agreement with previous reports. 2-4 Clinical and laboratory 3

4 features at time of presentation were compared between different DLBCL subgroups using the χ 2 test and the Spearman rank correlation. References 1. Hoover DM, Lubkowski J. DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis. Nucl Acids Res 2002;30:e Young KH, Leroy K, Moller MB, et al. Structural profiles of TP53 gene mutations predict clinical outcome in diffuse large B-cell lymphoma: an international collaborative study. Blood 2008;112: Bea S, Zettl A, Wright G, et al. Diffuse large B-cell lymphoma subgroups have distinct genetic profiles that influence tumor biology and improve gene-expression-based survival prediction. Blood 2005;106: Rosenwald A, Wright G, Chan WC, et al. The use of molecular profiling to predict survival after chemotherapy for diffuse large-b-cell lymphoma. N Engl J Med 2002;346:

5 Figure S1. Kaplan-Meier estimates of OS and PFS in DLBCL patients classified according to the presence of CDS mutations and of 3 UTR SNPs in the TP53 gene. (A) OS of patients with a WT-CDS. (B) PFS of patients with a WT-CDS. (C) OS of patients with a MUT-CDS. (D) PFS of patients with a MUT-CDS. 5

6 Figure S2. Kaplan-Meier estimates of OS and PFS in DLBCL patients classified according to the presence of CDS mutations and of 3 UTR SNVs in the TP53 gene. (A) OS of patients with a WT-CDS. (B) PFS of patients with a WT-CDS. (C) OS of patients with a MUT-CDS. (D) PFS of patients with a MUT-CDS. 6

7 Figure S3. Kaplan-Meier estimates of OS in DLBCL patients classified according to the status of the TP53 gene and gene expression profiling. (A) OS of ABC patients with or without nsnvs. (B) OS of GCB patients with or without nsnvs. (C) OS of ABC patients carrying a WT-CDS with or without nsnvs. (D) OS of GCB patients carrying a WT-CDS with or without nsnvs. (E) OS of ABC patients carrying a MUT-CDS with or without nsnvs. (F) OS of GCB patients carrying a MUT-CDS with or without nsnvs 7

8 Patient CDS 5UTR 3UTR 1 Total no. of UTR variants 1 WT 0 2 WT 20 C>T 1 3 WT 137 G>A, 731 G>A 2 4 WT 0 5 WT 0 6 Exon 5 & C>T, 521 C>T, 856 C>T 3 7 WT 471 C>T, 968 C>T 2 8 WT 0 9 WT 0 10 WT 0 11 WT 0 12 WT 183 G>A 1 13 WT 50 C>T, 339 G>A, 449 G>A, 722 C>T 4 14 WT 0 15 WT 0 16 WT 826 G>A, 1175 A>C 2 17 WT 0 18 Exon Exon WT 0 21 Exon C>T, 1 22 Exon WT 0 24 Exon WT 0 26 Exon WT 128 C>T 102 G>A, 536 G>A 3 28 Exon WT 0 30 WT 0 31 WT 0 32 WT 1144 C>T 1 33 WT 0 34 Exon WT 826 G>A 1 Table S1. TP53 gene status in 244 patients 8

9 36 WT 0 37 WT 0 38 WT 0 39 WT 0 40 WT 0 41 WT 0 42 WT 336 C>T 1 43 WT 299 C>T 1 44 WT 0 45 Exon T>C, 400G>A, 500 C>T, 1089 C>T 4 46 WT 299 C>T 1 47 WT 0 48 WT 0 49 Exon 5 56 C>T, 61 A>G 2 50 Exon 5 34 C>T, 190 G>A, 244 G>A, 311 T>C 4 51 WT 737G>A, 875 C>T, 1124 C>T 3 52 WT 485 G>A, 577 G>A, 580 G>A, 641 A>G 4 53 Exon C>T 1 54 WT 20 C>T 500 C>T, 826 G>A, 1075 T>C, 1201 A>G 5 55 WT 899 C>T 1 56 Exon WT 67 C>T 73 C>T 563 C>T, 793 C>T 4 58 WT 87 C>T 159 G>A 2 59 WT 503 C>T, 814 G>A 2 60 Exon WT 1205 G>A 1 62 Exon 4b 826 G>A 1 63 WT 409 C>T, 637 C>T 2 64 WT 499 C>T, 806 C>T 2 65 WT 969 C>T, 1189 C>T 2 66 WT 99 G>A, 646 C>T, 1062 G>A 3 67 WT 858 C>T, 1170 C>T 2 68 WT 468 C>T, 1114 C>T 2 69 WT 0 70 WT 509 G>A, 536 G>A 2 71 WT 75 G>A 1 72 WT 0 73 WT 0 74 WT 669 C>T, 1 75 WT 0 9

10 76 WT 205 G>A 1 77 Exon G>A, 251 G>A, 522 T>C 3 78 WT 357 T>C, 485 G>A 2 79 WT 485 G>A, 826 G>A 2 80 WT 0 81 Exon WT 0 83 WT 0 84 WT 826 G>A 1 85 WT 0 86 Exon G>A 1 87 Exon G>A 1 88 WT 0 89 WT 132 C>T 1 90 Exon WT 202 G>A, 425 C>T, 1070 C>T 3 92 WT 1190 C>T 1 93 Exon 8 20 C>T 1 94 WT 0 95 WT 137 G>A, 205 G>A 2 96 WT 0 97 WT 1101 C>T 1 98 WT 0 99 WT Exon C>T Exon 8 & Exon G>A, 1175 A>C WT Exon WT 138 T>C, 212 C>T WT 165 C>T, 392 A>G WT 896 G>A WT 434 G>A WT WT WT Exon WT WT WT Exon WT Exon 5 70 C>T 186 G>A, 665 C>T Exon WT 486 G>A, 985 C>T 2 10

11 121 Exon Exon WT 1084 T>C Exon WT WT WT WT 943 G>A WT WT WT WT WT WT WT WT WT 107 C>T WT WT WT WT WT WT 70 C>T 16 G>A, 525 C>T, 900 C>T Exon G>A 826 G>A WT 93 G>A, 475 T>C WT WT 255 G>A Exon C>T WT 625 C>T WT WT 191 G>A WT WT WT 485 G>A WT 826 G>A WT WT 38 C>T, 740 T>A Exon WT WT WT 375 C>T WT WT WT 826 G>A WT 0 11

12 166 WT WT WT 1004 C>T WT Exon WT WT 613 C>A WT Exon 4b Exon C>T WT 406 G>A WT 977 G>A WT 625 C>T WT 485 G>A WT WT 485 G>A WT 1189 C>T Exon WT 826 G>A Exon A>G, 826 G>A WT 485 G>A WT WT 485 G>A WT WT WT 485 G>A WT 826 G>A WT WT Exon A>G WT WT WT WT Exon WT WT 46 G>A WT 401 C>T, 601 G>A WT 960 C>T WT WT 573 G>A WT 664 C>T WT WT Exon G>A 1 12

13 211 WT 826 G>A WT 826 G>A, 1175 A>C WT 915 C>A WT WT WT 113 G>A, 213 C>T WT 59 G>A 68 C>T 568 G>A WT Exon G>A WT WT WT 485 G>A WT WT Exon WT Exon WT 665 C>T WT WT WT 826 G>A, 1055 T>C WT 409 C>A WT WT WT WT WT WT Exon G>A WT WT WT 159 G>A 205 G>A Exon 6 7 C>T, 794 T>A WT 1033 A>G, 1062 G>A 2 1 Variants listed in dbsnp are underlined. 13

14 Table S2. Clinical and biological characteristics of 244 DLBCL patients and their impact on OS and PFS 1. N % OS (P value) PFS (P value) Patients Median age 60 yr <60 yr Sex F M Tumor stage I-II III-IV < < LDH 1 Normal High Performance status or more < < B-symptoms 1 No Yes IPI risk group < < Values for lactate dehydrogenase (LDH) and B-symptoms were available for 215 patients, IPI values were available for 210 patients, and performance status was available for 204 patients. 14

15 Table S3. 3 UTR variants in the second group of patients (n=247) 1 Total Patient 3UTR variants 1 SNVs C>T A>G C>T 761 T>C 1144 C>T G>A 826 G>A 969 C>T G>A C>T C>T 555 C>T 968 C>T G>A 253 G>A 621 A>G 707 C>T T>A G>A G>A C>T 716 C>T C>T 1 15

16 C>T 435 G>A T>C T>A* T>C C>T C>T 686 T>C 826 G>A C>T C>T C>T 1066 G>A G>A G>A G>A

17 C>T G>A G>A 568 G>A G>A 826 G>A G>A G>A G>A 1175 A>C G>A C>T 1119 C>T C>T C>T 1089 C>T 1189 C>T C>T G>A G>A 1070C>T C>T 205 G>A 484 G>A 581 G>A G>A 949 A>G G>A 602 C>T 1131 C>T G>A 1082 C>T

18 G>A G>A 422 G>A 900 C>A C>T G>A G>A T>G G>A 287 G>A G>A G>A G>A C>T G>A G>A 1049 A>G C>T G>A 399 G>A G>A 826 G>A 1175 A>C

19 T>G G>A C>T 510 G>A 826 G>A 1175 A>C A>G C>T C>T 805 C>T 969 C>T 1076 C>T C>T C>T 737 G>C G>A T>C 856 C>T C>T G>C C>T G>A 739 G>C 805 C>T 1071 A>G T>C C>T 379 G>A C>A G>A C>T C>T G>A C>T G>A C>T 485 G>A 867 C>T G>A G>A C>A

20 G>A 1175 A>C G>A 184 T>C 389 G>A T>C 584 T>C 628 C>T G>A T>C 1183 C>T G>A G>A G>A Variants listed in dbsnp are underlined 20

21 Table S4. Frequency of recurrent SNVs in the TP53 3 UTR in the combined group of 491 DLBCL patients Nucleotide position of the SNV 1 Occurrence

22 SNPs listed in dbsnp are underlined. 22

23 Table S5 The association of p53 protein expression and 3 UTR nsnvs in 244 patients Group 3 UTR Average p53 level p53 notoverexpressed p53 overexpressed (>50%) The entire No nsnv 19% n=138 n=23 n=7 cohort With nsnv 20% n=65 n=10 n=1 The WT- No nsnv 13% n=121 n=8 n=7 CDS group With nsnv 13% n=56 n=3 The MUT- No nsnv 43% n=17 n=15 CDS group With nsnv 45% n=9 n=7 n=1 Unknown 1 Statistical values for the difference P= %CI: P= %CI: P= %CI: Unknown, there is no call in p53 nuclear staining. 23

24 Table S6. Predicted deamination hotspots in the TP53 3 UTR Position of the nucleotide G or C 1 RGYW WRCY (1) (1) (1) (2) (1) (1) (1) (1) (1) (2) (1) (1) (2) (1) (2) 24

25 985 (1) (1) The number in parenthesis indicates SNV occurrences at this nucleotide G or C in 491 patients. 25